X
تبلیغات
پرورش قناری - شناخت جنسیت قناری
آموزش
يک شخص مبتدی مشکل ترِن و مهمترِين کار در وهله اول شناختن جنسيت پرنده  است. از اين لحاظ به خريداران و علاقه مندانی که تازه می خواهند قناری ابتياع کنند توصيه می شود که در اين مورد با فروشنده با تجربه و قابل اطمينان وارد معامله شده و  متذکر شوند تا در صورت تشخِص اشتباه بتوانِيد پرنده را تعويض نمائيد.  همان طور که گفته شد تشخيص نر يا ماده بودن پرنده کار آسانی نيست اما بين جنس نروماده قناری اختلافاتی وجود دارد که نياز به تجربه و دقت کافی دارد.  اگر قناری نر لال نباشد بهترين دليل وجه تمايز برای تعيين جنسيت آواز خواندن قناری است.قناری ماده هم ممکن است آواز بخواند اما آواز آنها قدرت چندانی ندارد و به صورت منقطع ودارای لرزش می باشد ليکن متاسفانه در هنگام ضرورت وسيله ای نيست که پرنده را وادار به آواز خواندن نمود می بايست به موارد ذيل بيشتر توجه نمود. 

 

در نرهای آماده جفت گيری ناحيه مخرج برجسته و دارای چين های مختصری است که در پرنده ماده وجود ندارد.

 

چشمان قناری نر دارای جلای بيشتری می باشد که نشان دهنده شجاعت و اعتماد به نفس است که در ماده کمتر است .

 

حرکات ماده عموما کند ترو کمتر از نرهاست به اصطلاح قناری نر دارای شادابی وتحرک بيشتری است.

 

جمجمه قناری نر در قسمت فوقانی کمی پهـن تر از جنس ماده می باشد.

 

 رنگ آميزی پرهای قناری نر زيبا تر و شفاف تر از رنگ ماده ميباشد.

 

درقناریهای نر بالغ زیر منقار پرهایش کمی پف کرده است.

 

قناری نر دارای چثه بزرگتری نسبت به ماده می باشد.

 قناریهای ماده منقار روشنتری نسبت به نرها دارندب

تعیین جنسیت قناری با استفاده از روش PCR

 

تعیین جنسیت قناری با استفاده از نشانگر های ژنتیکی

چکیده:
تعیین جنسیت اغلب پرندگان تا زمان بلوغ و حتی گاهی بعد از بلوغ امری نسبتا مشکل است. اما جنسیت پرندگان و سایر جانوران از بدو تشکیل نطفه، به لحاظ ژنتیکی معین است. امروزه با پیشرفت روش های مولکولی، تعیین جنسیت جانداران در هر مرحله از زندگی میسر می باشد. در تحقیق حاظر تعیین جنسیت در قناری با استفاده از واکنش PCR و براساس دو ژن CHD-W و CHD-Z شرح داده شده است. در این تحقیق جمعا از 29 قطعه قناری استفاده شد. استخراج DNA از انتهای کالاموس پر قناری های زنده صورت پذیرفت و با استفاده از پرایمرهای اختصاصی طراحی شده در این طرح، واکنش PCR تنظیم گردید. نتایج نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و فقط یک باند 306 جفت باز برای جنس نر بود. این نتایج برای کلیه نمونه های پر مشاهده شد. از آنجا که طراحی این سیستم تعیین جنسیت برای اولین بار در قناری مورد استفاده قرار می گیرد و نتایج مولکولی با ویژگی های مورفولوژیک دو جنس نر و ماده کاملا مطابقت دارد، لذا تعیین جنسیت جوجه های قناری با انجام واکنش PCR روی نمونه های پر، آسان، سریع، بی خطر و ارزان می باشد.

مقدمه:
قناری ها (Serinus canaria canaria) از جمله زیباترین پرندگان خانگی هستند که از زمان های بسیار دور نگهداری آنها به خاطر آواز دلنشین و رنگ آمیزی زیبایشان رایج شده و مورد توجه مردم سراسر دنیا قرار گرفته است. طبق دسته بندی سیستماتیک زیست شناسی، قناری وحشی به راسته گنجشک ها (Passeriformes) و به خانواده فنچ ها (Fringillidae) تعلق دارند. با توجه به اینکه قناری ها از زمان بلوغ شروع به آواز خواندن می کنند و صدای زیبای قناری ها بیشتر توسط جنس نر تولید می شود، به همین دلیل جنس نر این پرنده نسبت به جنس ماده از لحاظ اقتصادی دارای ارزش بیشتری است و با قیمت افزون تری نسبت به جنس ماده به فروش می رسد (1، 2و 3). یکی از بهترین راه ها برای تمایز دادن پرندگان نر و ماده استفاده از روشهای مولکولی بر اساس DNA  است. یافتن یک نشانگر مولکولی مناسب برای تعیین جنسیت، کاری دشوار است. از آنجا که ژنوتیپ پرنده ماده ZW و ژنوتیپ پرنده نر ZZ می باشد، لذا کروموزوم W فقط در جنس ماده پرندگان وجود دارد و بر اساس آن می توان مارکر ژنتیکی مناسبی برای تفکیک جنس های نر و ماده از هم یافت. این ویژگی همانند کروموزوم Y در انسان است با این تفاوت که در انسان و سایر پستانداران، جنس نر هتروگامتیک است و جنس ماده هموگامتیک می باشد ولی در پرندگان وضعیت دقیقا عکس است (4و5). برخی از ژنهای موجود بر روی کروموزوم W بسیار حفظ شده بوده و با استفاده از این گونه ژن ها می توان در تمام گونه های پرندگان، جنسیت پرنده را با استفاده از یک جفت پرایمر و طی یک مرحله انجام واکنش PCR تعیین کرد (6). در برخی از پرندگان، نظیر پرندگان عظیم الجثه مانند شترمرغ، پرایمرهای مربوط به ژن CHD، سبب تکثیر قطعاتی در هر دو ژن CHD-W و CHD-Z می گردد زیرا این پرایمر ها همزمان با هم قسمت های هومولگ از ژن CHD-W و ژن مرتبط آن یعنی CHD-Z را تکثیر می نمایند اما در این قطعات تکثیر شده، تفاوت طول مشاهده می گردد و از همین خاصیت می توان به منظور تعیین جنسیت پرندگان بهره گرفت (7و8). هدف از این تحقیق تنظیم روش PCR برای تعیین جنسیت قناری برای اولین بار با پرایمرهای جدید طراحی شده می باشد.

مواد و روش کار:
به منظور تعیین جنسیت قناری جمعا از 29 قطعه قناری نمونه گیری به عمل آمد. نمونه گیری از انتهای کالاموس پر قناری های زنده (11 ماده و 6 نر و12 جوجه قناری با جنسیت نامعلوم) صورت گرفت و‌DNA ی ژنومی با استفاده از روش استاندارد فنل-کلروفرم استخراج گردید و جهت اطمینان از کیفیت DNA و مشاهده قطعات DNAی استخراج شده از ژل آگارز 1 درصد و رنگ آمیزی توسط اتیدیوم برماید استفاده شد، همچنین کیفیت DNA استخراج شده توسط دستگاه اسپکتروفوتومتر نیز بررسی گردید. به منظور انجام PCR، نیاز به پرایمرهای اختصاصی تعیین جنسیت می باشد که بر اساس ژن CHD قناری طراحی گردند. اما پس از انجام مطالعات بسیار، توالی ژن CHD قناری یافت نشد لذا به منظور طراحی پرایمر از توالی ژن CHD-W مربوط به پرنده ای با نام علمی Hemispingus frontalis که از خانواده Fringillidae می باشد و قرابت فیلوژنتیکی بالایی با Serinus canaria دارد، استفاده شد. توالی پرایمرهای طراحی شده برای این تحقیق به صورت زیر است:

Canary-F: 5'- GGATGAGGAACTGTGCAAAAC -3'

Canary-R: 5'- AATAGTTCGCGGTCTTCCAC -3'

 برای انجام واکنش PCR حجم نهایی واکنش 25 میکرولیتر بوده که شامل: 20 نانوگرم DNA الگو، 2 میلی مولار MgCl2، 25 پیکومول از هر پرایمر، 1 واحد آنزیم DNA پلیمراز Taq و200 میکرو مولار dNTP Mix  بود. برای انجام واکنش PCR از دستگاه مسترسایکلر گرادینت شرکت Eppendorf استفاده شد. برنامه ی حرارتی مورد استفاده شامل: 95 درجه سانتی گراد 5 دقیقه، سپس 30 چرخه دمایی به ترتیب 94 درجه سانتی گراد 1 دقیقه، 58 درجه سانتی گراد 1 دقیقه و 72 درجه سانتی گراد 1 دقیقه و یک مرحله نهایی 72 درجه سانتی گراد 5 دقیقه تنظیم گردید. سپس محصولات PCR با ژل آگارز 5/1 درصد الکتروفورز گردید و توسط اتیدیوم برماید رنگ آمیزی شد و با استفاده از نور UV مورد ارزیابی قرار گرفت.

نتایج و بحث:
از کالاموس پر پرندگان مورد آزمایش، DNAی ژنومی با موفقیت استخراج گردید و کیفیت DNA ی استخراج شده با استفاده از روش طیف سنجی و الکتروفورز روی ژل آگارز 1 درصد تعیین گردید. سپس غلظت DNA استخراج شده به میزان ng/μl 20 تنظیم شد. انجام PCR با پرایمرهای اختصاصی طراحی شده ی تعیین جنسیت در قناری و مشاهده ی نتایج حاصل  بر روی ژل آگارز 5/1 درصد نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و یک باند 306 جفت باز برای جنس نر بود که در ژل آگارز مشاهده می شود.
نتایج حاصل نشان می دهد، تعیین جنسیت قناری با استفاده از این روش، بسیار سریع، دقیق و کم هزینه بوده و در هر دوره از زندگی این پرنده می تواند بکار رود. از آنجایی که تعیین جنسیت پرندگان با استفاده از روش های قدیمی مانند لمس کلواک، سنجش میزان استروئید، کاریوتایپینگ و... دشوار و زمانبر می باشد و حتی در برخی موارد موجب مرگ پرنده می شود(9) لذا محققین متعددی تا کنون در راستای تعیین جنسیت مولکولی موجودات تلاش نموده اند و برخی نیز به نتایج مطلوبی دست یافته اند. برای مثال در سال 1998 Griffiths و همکاران با استفاده از دو ژن CHD-W و CHD-Z و طراحی پرایمر های متعدد، به تعیین جنسیت گروهی از پرندگان (شتر مرغ، قو، کبوتر، غاز وحشی و ...) پرداخته اند (10). در سال 2000، Nesje و همکاران سعی کردند با استفاده از دو جایگاه میکروستلایتی، پرندگانی از قبیل شاهین، باز وحشی، قوش و غیره را تعیین جنسیت نمایند اما این روش در تعیین جنسیت برخی از پرندگان مورد آزمایش موفقیت آمیز نبود (11). همچنین در سال 2004، Agate و همکاران برای تعیین جنسیت Zebra Finches از ژن CHD1-Z و CHD1-W استفاده کردند (12). در این تحقیق با توجه به اینکه توالی ژنهای CHD-W و CHD-Z مربوط به قناری در بانک ژن جهانی ثبت نگردیده اند، لذا همان طور که در بالا اشاره شد، از روی توالی ژن CHD-W مربوط به پرنده ای شبیه به قناری، ترتیب نوکلئوتیدی پرایمرها انتخاب و نتایج مطلوبی در مورد تعیین جنسیت قناری بدست آمد. این سیستم تعیین جنسیت مولکولی بر اساس PCR که برای قناری ماده دو قطعه DNA و برای قناری نر، یک قطعه DNA تکثیر می نماید برای اولین بار تنظیم و معرفی می گردد.
رای
.

+ نوشته شده در  یکشنبه 1388/05/04ساعت 18:46  توسط محمودسیدی |